Trabajos Originales

Detección del virus Epstein-Barr en lesiones de liquen plano bucal

Recibido para arbitraje: 29/04/2009
Aceptado para publicación: 08/06/2009

  • Arreaza A; Od., MSc., Profesor Asistente Facultad de Odontología.

  • Correnti M; PhD., Profesor Asociado Instituto de Investigaciones Odontológicas Rául Vincentelli Facultad de Odontología UCV. Instituto de Oncología y Hematología.

  • Avila M; Lic. Instituto de Oncología y Hematología MPPPS. Universidad Central de Venezuela,

    Correspondencia: Alven Arreaza
    E-mail: alvenjesus@yahoo.com.mx
Resumen:
Objetivo: El objetivo del estudio fue detectar la presencia de Virus Epstein-Barr (VEB) en pacientes con lesiones de Liquen Plano Bucal (LPB) usando la Reacción en Cadena de la Polimerasa (PCR), y relacionarlo con el consumo de cigarrillo en un grupo de pacientes Venezolanos.

Materiales y Métodos: En el estudio se incluyeron 20 pacientes con LPB y un grupo control de 10 individuos con mucosa bucal sana sin antecedentes de LPB. Las muestras fueron divididas en tres fragmentos; uno se incluyó en parafina para el diagnóstico histopatológico, otra porción de tejido no-ulcerado para inmunofluorescencia directa, usando anticuerpos policlonales anti-fibrinógeno y otra fue congelada a -70°C para el análisis molecular

Resultados: En los pacientes con LPB se presentó un predominio del género femenino (95%). En el análisis histopatológico se observó que el 90% de los tejidos de LPB presentaban acantosis, y 80% degeneración hidrópica del epitelio, 50% Cuerpos de Civatte y papilomatosis respectivamente, 35% hiperparaqueratosis y 30% hiperortoqueratosis. Todas las muestras mostraron infiltrado inflamatorio linfocítico a lo largo de la unión corión-epitelio. La localización de las lesiones fue más frecuente en cara interna de carrillo (85%).

El análisis molecular demostró la presencia del genoma de VEB en 50% (10/20) de los pacientes con LPB. En el grupo control, solo un caso fue positivo (10%), siendo la diferencia entre los dos grupos estadísticamente significativa (P<.0005). De los 10 pacientes con LPB positivos para la infección por VEB, el 40% (4/10) eran fumadores y el único paciente positivo para VEB en el grupo control resultó no fumador.

Conclusion: Se observó una mayor frecuencia de infección por VEB en los pacientes con LPB en relación al grupo control. No se encontró diferencia estadísticamente significativa entre los pacientes LPB/VEB+ y LPB/VEB-. No se encontró relación entre el hábito tabáquico y la presencia de VEB ya que el 60% de los pacientes VEB positivos no eran fumadores.

Palabras claves: Epstein-Barr, Liquen Plano Bucal, Nested-RCP


Abstract
Objective: The aim of this work was to detect the presence of EBV in Oral Lichen Planus (OLP) lesions using the Polymerase Chain Reaction (PCR), and to correlate with cigarette smoking in a OLP Venezuelan population.

Study Design: A group of 20 OLP patients were included. A control group consisted of 10 individuals with healthy oral mucosa and with no history of OLP. Three fragments of the sample were obtained; one for histological diagnosis, another placed in saline solution (fresh not-ulcerated tissue) for direct immunofluorescence with polyclonal antibodies anti- fibrinogen, and the other frozen at -70°C in liquid nitrogen for molecular analysis.

Results: We found a predominance of the female gender in the OLP group (95%). The acantosis was presented in 90% (18/20) of the cases, following by epithelial hydropic degeneration (16/20), civatte´s bodies (10/20) papillomatosis (10/20) hyperparaqueratosis (7/2)0, hyperorthoqueratosis (6/20). All the samples showed inflammatory infiltrate spread into the chorion-epithelial join as the principal histological feature. The more frequent location was the mucosa of the cheek (85%).The presence of the EBV genome was observed in 10/20 (50%) of OPL patients. In the control group only one case was positive (10%). There were statistical significant differences (P<.0005). Of the 10 OLP positive EBV patients, 40% (4/10) were cigarettes smokers, and the only positive patient in the control group was not. there is no correlation between the use of cigarettes and the presence of EBV in OPL patients..

Conclusions: We found a major frequency of the VEB infection in the OLP group than in the control group. There was no statistical differences between the groups OLP/EBV+ and OLP/EBV-. There is no relation between tobaccos consumed and the presence of the virus, cause 60% of the EBV positives patients were no smoking.

Key word: Epstein-Barr infection, Oral Lichen Planus, Nested-PCR


Introducción

El Liquen Plano Bucal es una enfermedad autoinmune que afecta la piel y las mucosas. La lesión se presenta en respuesta a una variación antigénica del epitelio y frecuentemente se presenta de manera inicial en la mucosa bucal, lo cual favorece el diagnóstico primario en el consultorio odontológico (1, 2).

En la piel, se presenta como pápulas y placas pruriginosas. Frecuentemente adopta la apariencia clínica de líneas o placas blanquecinas en mucosa bucal, encía o lengua, que se conocen con el nombre de "estrías de Wickhan". Vesículas, eritema y erosiones se pueden llegar a observar en cavidad bucal, sobre todo en las formas erosivas de la enfermedad. Las lesiones pueden afectar en muchos casos, tanto piel como mucosa, solamente la piel o en casos poco frecuentes; solamente la mucosa (1).

La localización bilateral de las lesiones, permite diferenciar al LPB de las reacciones liquenoides a fármacos o materiales dentales (3). Solo la variante erosiva del LPB produce síntomas que incluyen dolor y/o ardor y en ocasiones sangramiento de las lesiones ulcerosas (1).

Hasta la actualidad, el agente etiológico específico del LPB no ha sido identificado. Sin embargo, algunos autores sugieren que el inicio y mantenimiento de las lesiones requieren de la activación de células T específicas en contra de un antígeno. Numerosos estudios se han enfocado en buscar la naturaleza del antígeno pero esta sigue siendo controversial (1, 4, 5).

Existen estudios que han demostrado el potencial de transformación maligna de las lesiones de LPB, lo que ha contribuido a que sea considerada como una entidad "pre-maligna" (4, 6).

Uno de los factores mencionados dentro de la etiología del LPB es la infección viral. Se ha asociado la presencia de infección por virus de hepatitis C, así como de Virus Epstein-Barr con la patogénesis de LPB (7,8).

VEB es una particula constituida por una doble cadena de ácido nucleíco rodeada por una nucleocápside lipoprotéica con algunas proyecciones de glicoproteínas. El tamaño del virión es de 120-200 nm. VEB es un agente mitógeno inespecífico de las células B y puede estimular la producción de auto-anticuerpos. Además VEB produce una disminución en la función de las células T supresoras (9, 10). Por otro lado, VEB se ha asociado a lesiones ulcerativas bucales, leucoplasia vellosa, y lesiones de LPB (11, 12, 13, 14).

Este virus se transmite generalmente por la saliva e inicialmente afecta las células de la orofaringe. Luego de una fase de replicación es diseminado a los linfocitos B. Aunque la infección es latente en las células B, con muy poca o ninguna replicación; algunas condiciones clínicas han sido asociadas a su presencia, tales como; Linfomas, Carcinomas Nasofaríngeos y Síndrome de Sjögren (15, 16).

Algunos virus inducen una proliferación celular descontrolada in vivo. En ese sentido la apoptosis es un importante mecanismo de defensa de las células ante la infección viral, debido a que la destrucción temprana de las células infectada, puede reducir enormemente la tasa de replicación y el número de virus producidos en la célula infectada. Por eso, los virus son capaces de retrasar o suprimir la apoptosis afectando la transcripción y traducción de proteínas que participan activamente en los procesos apoptóticos. (8,17)

Los virus afectan la apoptosis mediante mecanismos que afectan la transcripción de genes supresores de tumores como el de la p53, el receptor Fas, y mediante la producción de inhibidores de caspasa, o como lo hace VEB; mediante la producción de homólogos de la Bcl-2 (gen antiapoptótico). VEB también evade la acción de los interferones, mediante la inhibición del JAK-STAT (Janus Kinase-signal transducer and activator of transcription) el cual es una vía de transducción de señales indispensable para la producción de interferones (17).

El Complejo Mayor de Histocompatibilidad (CMH) clase I que restringe la respuesta de las células T, puede ocasionar una condición letal a las células infectadas antes de que ocurra la replicación viral. Los virus tienden a desarrollar estrategias para destruir los componentes del CMH dentro del macrófago, alterando la presentación de antígenos e interfiriendo además con el tráfico intracelular de las moléculas del CMH. Los virus atacan las moléculas del CMH-I en casi todas las etapas del tráfico celular: en el retículo endoplasmático, en el citoplasma y el transporte hacia la superficie de la membrana y aún después que el CMH ha alcanzado la superficie celular. VEB codifica un dominio de glicina-alanina (GAr) en el antígeno nuclear viral (EBNA 1) que inhibe la degradación y procesamiento de las proteínas virales en antígenos, mediante la inhibición de la proteólisis dependiente del sistema ubiquitina/proteasoma que a su vez, también depende de la producción de interferon gamma que ha sido disminuida por el mismo virus, impidiendo que el sistema inmunológico pueda reconocer las células infectadas y por lo tanto garantizando la supervivencia de las mismas (17).

El objetivo de este estudio fue detectar la presencia del VEB en pacientes con LPB mediante el uso de la Reacción en Cadena de la Polimerasa (RCP) y correlacionar este dato con el consumo de cigarrillo.


MATERIALES Y METODOS
En este estudio se incluyeron un grupo de 20 pacientes con LPB y un grupo control compuesto por 10 individuos con mucosa bucal sana y sin antecedentes de LPB. Estos últimos fueron atendidos en el postgrado de cirugía bucal para practicarse exodoncias a colgajo de los terceros molares.

Se excluyeron del estudio; pacientes con lesiones liquenoides en vecindad con restauraciones metálicas y/o acrílicas, pacientes con medicaciones sistémicas antihipertensivas, hipoglicemiantes y antidepresivas, pacientes con enfermedades inmunológicas como lupus eritematoso sistémico, eritema multiforme, enfermedad de rechazo de injerto y SIDA. Y finalmente se excluyeron del estudio a pacientes con carcinomas o displasias epiteliales.

En todos los casos se completó un cuestionario que incluía: datos personales, enfermedad actual, hábitos, antecedentes médicos, localización y características clínicas de las lesiones, diagnóstico histopatológico, inmunofluorescencia directa y hematología completa. Todos los pacientes firmaron el consentimiento informado para participar en la investigación y se recibió la aprobación del comité de bioética de la Institución donde se llevo a cabo (Facultad de Odontología de la Universidad Central de Venezuela).

En todos los casos se registraron los siguientes datos: información personal (nombre, edad, lugar de nacimiento y procedencia), enfermedad actual, hábitos, antecedentes médicos, localización de la lesión y características clínicas, diagnóstico histopatológico e inmunofluorescencia directa.

El material biológico consistía en muestras no-ulceradas de mucosa bucal, tomadas bajo anestesia local (lidocaina 2%, epinefrina 1:100.000 A.T.O.TM Zizine, Paris France) tomando en cuenta los criterios de exclusión. Las muestras fueron divididas en tres fragmentos; uno para estudio histopatológico (fijado en solución de formalina, embebido en parafina y coloreado con hematoxilina y eosina), otro mantenido en solución salina (tejido fresco) para inmunofluorescencia directa con anticuerpos policlonales anti-fibrinógeno (Dako Corporation, Conpenhagen, Denmark) y otro congelado a -70°C en nitrógeno líquido para análisis molecular.

Extración de ADN.- todas las muestras fueron disueltas en 450 µl de TE-buffer estéril (50 mmol/L ácido etilendiaminotetracetico; 10 mmol/L tris-HCL, pH 7.5 estéril) a la cual se le agregó 50 µl de 10 mg/mL proteinase K. Las muestras se incubaron toda la noche en baño de maría a 37°C previo a la extracción de ADN con cloroformo-fenol. Durante el proceso de extracción, se incluyeron controles negativos para descartar contaminación.

RCP para VEB.- Los iniciadores (primers) usados en la prueba nested- PCR así como las condiciones de la misma fueron de acuerdo a las propuestas por Sand et al. 2002. Los iniciadores externos contenía la secuencia; 5' CTAGGGGAGAACGTGAA 3' (W1; nucleótidos 14555-14575, hebra complementaria y anti-paralela) y 5' CTGAAGGTGAACCGCTTACCA 3' (W2; nucleótidos 14310-14380 hebra complementaria y anti paralela); el set de iniciadores internos consistía en; 5' GGTATCGGGCCAGAGGTAAGT 3' (W3; nucleótidos 14605-14625 hebra complementaria y antiparalela); y 5' GCTGGAGGACCCCTTCTAC 3' (W4; nucleótidos 14777-14797 hebra complementaria y anti-paralela). La amplificación del genoma de VEB se realizó empleando 2.5 µl deADN en 25 µl de solución que contenía 10 mmol/L tris-HCL (pH 8.3), 50 mmol/L KCL, 1.2 mmol/L MgCL2, 200 µmol/L de cada deoxy ribonucleosido trifosfato y 20 pmol del respectivo iniciador, 1.25 of Taq polimerasa y agua hasta alcanzar un volumen 25 µL. Con el iniciador externo, se realizaron 30 ciclos de amplificación: 92°C por 45 segundos, 66°C por 30 segundos y 72°C por 45 segundos. Del material amplificado, se usaron 2.5 µL para amplificar el ADN con el iniciador interno, aplicando 40 ciclos.

El control positive utilizado fue ADN de la línea celular B95-8 (carcinoma nasofaríngeo) positivo para VEB un control negativo solo agua, y como control interno se utilizó la beta-actina.

El producto de la PCR fue analizado mediante electroforesis en un gel de agarosa al 3 %, coloreado con bromuro de etidio y las bandas fueron visualizadas mediante luz UV para su registro fotográfico.

Los resultados fueron recogidos usando el software Excel® (office® 2007) y procesados mediante el Fisher Exact Test para su análisis estadístico.


RESULTADOS
En los pacientes con LPB se presentó un predominio del género femenino (95%). El promedio de edad del grupo de los pacientes con Liquen Plano Bucal, fue de 50,85 ± 14.8 (X ± DS). Con un rango de edad entre 28 y 75 años. Para el grupo control el promedio de edad fue de 38,6 ± 19.43 (X ± DS) con un rango de edad entre 21 y 85 años.

La localización de las lesiones fue más frecuente en cara interna de carrillo (85%).

En el análisis histopatológico se observó que el 90% (18/20) de los tejidos de LPB presentaban acantosis, y (16/20), degeneración hidrópica del epitelio, (10/20) Cuerpos de Civatte y papilomatosis respectivamente, (7/20) hiperparaqueratosis y (6/20) hiperortoqueratosis. Todas las muestras mostraron un infiltrado inflamatorio linfocítico a lo largo de la unión corión-epitelio, siendo esta la característica histológica principal (Tabla 1)

Tabla 1
Características Histopatológicas de las muestras de pacientes con LPB

El análisis molecular mediante Nested-RCP empleando los iniciadores internos y externos, demostró un producto amplificado de 192 pb correspondiente al genoma de VEB, observándose una banda en todos los casos positivos para la infección viral. (fig 1)

Fig.1
Detección molecular de VEB en pacientes con LPB.
carril 1 Marcador de peso molecular de 192 pb.
carril 2: control positivo.
carriles 3 y 5: pacientes VEB positivos.
carriles 4, 6 y 7: pacientes negativos.
carril 8: control negativo

resultó positivo (10%). La diferencia entre los grupos fué estadísticamente significativa (P<.0005) (Tabla 2)

Tabla 2
Distribución de la infección por VEB en pacientes con LPB y en el grupo control

Al evaluar la relación de consumo de cigarrillos y la presencia de infección por VEB, se observó que de los 10 pacientes positivos para VEB el 40% (4/10) eran fumadores y el 60% (6/10) no presentaban este hábito. El único paciente VEB positivo del grupo control era no-fumador (tabla 3). No se observó una correlación estadísticamente significativa entre el consumo de cigarrillos, la presencia del VEB y/o la presencia del LPB.

Tab.3
Distribución de los pacientes con LPB y el grupo control positivos para VEB de acuerdo al hábito tabáquico.

DISCUSIÓN

La prevalencia general de LPB ha sido reportada en diferentes poblaciones entre 0.1 y 4% (18), Existen evidencias que involucran a la respuesta inmunologiaca en la etiología de LPB, sin embargo el antígeno responsable de la inducción de LPB todavía no se ha identificado, aunque se han propuesto a agentes virales como factores etiológicos (19). EBV se ha asociado con lesiones malignas y benignas en la región de cabeza y cuello (20).

La presencia de VEB se ha demostrado en epitelio oral normal así como en carcinoma de células escamosas oral (20). La contribución de VEB en el desarrollo de malignidad no está aún dilucidada.

El Liquen Plano Bucal e una enfermedad inmunológica crónica con períodos de recuperación y recaídas que se caracteriza por la existencia de desorden en la capa espinal de epitelio. Las características histopatológicas de las muestras evaluadas en nuestro estudio coinciden con las reportadas por otros autores, en particular en lo referente, al infiltrado inflamatorio a lo largo de toda la unión corión-epitelial como la principal característica histopatológica (1, 4, 21).

En relación a la infección viral en pacientes con LPB, una asociación entre la presencia de VEB y LPB ha sido sugerida anteriormente por varios autores (12, 13, 22). Los resultados del presente trabajo demuestran una alta prevalencia (50%) del genoma de VEB en los pacientes con LPB, sin embargo, no es posible señalarlo como agente etiológico. Más aún, es probable que el LPB no tenga un solo agente etiológico, sino más bien un conjunto de agentes y condiciones actuando simultáneamente. Además se ha planteado que condiciones como los aspectos psicoemocionales pudieran jugar un rol importante en la patogénesis de estas lesiones (23).

Se ha reportado también una correlación entre VEB y algunas condiciones bucales como leucoplasia (11, 12). Sin embargo; no está claro si la infección está relacionada con la patogénesis de la enfermedad o es secundaria a la aparición de las lesiones, como resultado de una posible inmunosupresión local. Más aún, no se ha podido determinar el rol específico de VEB y su potencial oncogénico en la progresión a displasia de algunas lesiones de LPB (15), En el presente trabajo, se sugiere una posible relación entre la infección por VEB y las lesiones de LPB, ya que cabe destacar que solamente un caso fue positivo para la presencia de infección por VEB en el grupo control, aunque es conocido que aproximadamente el 90% de los individuos adultos tienen en circulación anticuerpos anti-VEB.

Otro factor que ha sido relacionado con el potencial de transformación neoplásica del LPB es el consumo de cigarrillos (7). Una combinación de factores que incluyan el consumo de cigarrillos y la infección por VEB podría estar asociada con la etiología del LPB, o una vez presente la enfermedad, potenciar su progresión a displasia epitelial y/o carcinoma.

Nuestro estudio mostró que había más fumadores en el grupo de pacientes con LPB en comparación con el grupo control aunque las diferencias no fueron estadísticamente significativas. No se observó correlación entre el hábito de fumar y los pacientes con LPB que presentaron infección por VEB. Resultados similares fueron reportados por Sandy col. (2002) no encontrando correlación entre el consumo de cigarrillo y la presencia de VEB en pacientes con lesiones de LPB (12).

Se hacen necesarias investigaciones que incluyan seguimiento y un mayor número de pacientes con LPB, que permitan relacionar episodios de recurrencias de las lesiones, en los pacientes fumadores VEB positivos en relación a los pacientes fumadores VEB negativos.


CONCLUSIONES
Se observó una mayor frecuencia de infección por VEB en los pacientes con LPB en relación al grupo control. No se encontró diferencia estadísticamente significativa entre los pacientes LPB/VEB+ y LPB/VEB-. No se encontró relación entre el hábito tabáquico y la presencia de VEB ya que el 60% de los pacientes VEB positivos no eran fumadores.


Agradecimientos: FONACIT PG- 2005000408


REFERENCIAS

  1. Rasool S, Ali A, Bashir F. Oral Lichen Planus. J Coll Physicians Surg Pak. 2007 Dec; 17(12):764-5

  2. Batista RF, Miranda JL, Gordón MA, Costa de Medeiros AM, Almeida R. Oral Lichen Planus with multiple clinical forms and familial history. Report of a rare case. Act Odontol Venez. 2004, 42(2); 110-13

  3. Wright J, Diagnosis and management of oral lichenoid reaction. J Calif Dent Assoc. 2007 Jun; 35(6): 412-6.

  4. Anuradha Ch, Reddy BV, Nandan SR, Kumar SR. Oral Lichen Planus: A Review. N Y State Dent J. 2008 Jun-Jul; 74(4): 66-8.

  5. Villarroel Dorrego M, Correnti M, Delgado R, Tapia FJ. Oral Lichen Planus: Immunohistology of mucosal lesions. J Oral Pathol Med. 2002 Aug; 31 (7):410-4.

  6. Ismail SB, Kumar SK, Zain RB. Oral Lichen Planus and Lichenoid Reaction: etiopathogenesis, diagnosis, management and malignant transformation. J Oral Sci. 2007 Jun; 49(2) :89-106.

  7. Carrozzo M. Oral diseases associated with Hepatitis C virus infection. Part 2: lichen planus and others diseases. Oral Dis. 2008 Apr; 14(3): 217-28. Epub 2008 Jan 22.

  8. Butel JS. Viral Carcinogenesis: revelation of molecular mechanisms and etiology of human disease. Carcinogenesis. 2000 Mar; 21(3): 405-26.

  9. Craig M. Pleitropic mechanisms of virus survival and persistence. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 2005; 100: S27-36.

  10. Posnett DN. Herpesviruses and Autoimmunity. Curr Opin Investig Drugs. 2008 May; 9(5): 505-14.

  11. Milagres A, Dias EP, Tavares Ddos S, Cavalcante RM, Dantas VA, de Oliveira SP, Leite JP. Prevalence of Oral Hairy Leucoplakia and epithelial infection Epstein-Barr Virus in pregnant women and diabetes mellitus patients cytopathologic and molecular study. Mem Inst Oswaldo Cruz. 2007 May; 102 (2):159-64.

  12. Sand LP, Jalouli J, Larsson P, Hirsch J. Prevalence of Epstein-Barr Virus in oral squamous cell carcinoma, oral lichen planus and normal mucosa. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. (2002); 93: 586-92.

  13. Pedersen A. Abnormal EBV immune status in oral lichen planus. Oral Dis. (1996); 2 (2): 125-8.

  14. Lee SH, Kim SD, Kim HR, Oh EJ, Yoon CH, Lee SH, Kim HY, Park SH. EBV- associated haemophagocytic symdromein a patient with Beçet's disease. Scand J Rheumatol. 2005 Jul-Aug; 34(4): 320-3.

  15. Choy EY, Siu KL, Kok KH, Lung RW, Tsang CM, To KF, Kwong DL, Tsao SW, Jin DY. An Epstein-Barr Viruses encoded microRNA targets PUMA to promote host cell survival. J Exp Med. 2008 Oct 6. [Epub ahead of print]

  16. Perrot S, Calvez V, Escande JP, Dupin N, Marcelin AG. Prevalences of herpesviruses DNA sequences in salivary gland biopsies from primary and secondary Sjögren's syndrome using degenerated consensus PCR primers. J Clin Virol. 2003 Oct; 28(2): 165-8.

  17. Miller CS, Lexington K. Pleiotropic mechanisms of virus survival and persistence. Oral Surg Oral Med Oral Pathol Oral Radiol Endod (2005); 100: S27-36.

  18. Scully C, Beyl M, Ferreiro M, Ficarra G, Gill Y, Giffiths M, Update on oral lichen planus etiopathogenesis and management. Crit Rev Oral Biol Med (1998) (1): 86 -107.

  19. Regezi J, Scubba J, Jordan CK Oral Pathology. (2003) 4th ed. W.B Saunders, Philadelphia, pp: 92-3

  20. Mao E, Smith C, Detection of Epstein-Barr virus (EBV) DNA by the polymerase chain reaction (PCR) in oral smears from health individuals an patientis with squamous cell carcinoma. J Oral Pathol Med, (1993) 22 (1): 12-7.

  21. Thornhill MH, Sankar V, Xu XJ, Barrett AW, High AS, Odell EW, Speight PM, Farthing PM. The role of histopathological characteristics in distinguishing amalgam-associated oral lichenoid reactions and oral lichen planus. J Oral Pathol Med. 2006 Apr; 35(4): 233-40.

  22. Oflatharta C, Flint SR, Toner M, Butler, Mabruk MJ. Investigation into a possible association between oral lichen planus, the human herpesviruses and the human papillomaviruses. Mol Diag. 2003; 7 (2): 73-83.

  23. Chaudhary S. Psychosocial stressor in oral lichen planus. Aust Dent J. 2004 Dec; 49(4): 192-5.